The Bio-Informatics Exercise Answer Template

Running head: THE BIO-INFORMATICS EXERCISE 1
THE BIO-INFORMATICS EXERCISE 4

The bio-informatics exercise answer template
Student name:
Professor:
Course:
Date:

QUESTION 1
Amino acids sequence of aid can be performed by the use of the various tools such as the protein sequencer machine. The device performing this fundamental function involves generating the sequence of the amino acids alignments in a protein molecule. The processing progress in the entire layer of the polypeptide is made till the whole amino acid sequence is achieved. At the advanced level, we can use the “blast” tool which is provided by the NCBI to generate regions of similarities existing between the biological sequences. This comprises of the nucleic acids and amino acids sequences of aid. The search results on amino acids of AID-generated 1831 results. The following are instances of the search result regarding the same;
· Illumina genome analyzer six paired-end sequencing; gene expression and alternative splicing analysis of breast carcinoma cells treated with cisplatin.
Accession: erx502999
· Illumina genome analyzer iix paired-end sequencing; gene expression and alternative splicing analysis of breast carcinoma cells treated with cisplatin.
Accession: erx502998
· Illumina miseq paired-end sequencing of samd00035623
Accession: drx037374
· Illumina miseq paired-end sequencing of samd00035623
Accession: drx037373
· Illumina miseq paired-end sequencing of samd00035623
Accession: drx037372
· Illumina hiseq 2500 sequencing; DNA methylation profiling of human naive embryonic stem cells
Accession: erx1327471
QUESTION 2
Yes, in the human genome, there exist several 3D structures. This is also true when the search is done for other species other than the human AID.Futhure search also saw that there were also some traces of 3D existing when the search was done for other proteins. Most interesting, this was found specifically in the proteins possessing sequence homology to the aid.The following is the PDB id of the structures found. For instances the twf1 is comprised almost entirely of two tandem repeats, each having sequence homology with cofilin scheffersomyces stip itis CBS 6054
371 aa protein
QUESTION 3
Calculating the theoretical (PI) of human AID.
This is done by identifying the positively charged molecules attracted to the negatively charged solid support enhancer. In this regard, the anion exchanged chromatograph including the negatively charged particles is deposited to the positive terminal.

When we have AID protein sample that needs to be purified by ion exchange chromatography, the buffer ion exchanger is appropriate for use under physiological pH (~7.0).

QUESTION 4
The search result to generate the cDNA sequence of human aid found different results. Mostly the predominant cancer cell in human support was found. The search id in this regard for instances was considered to be atcc crl.This existed in the human breast. The type of cell was epitherial and evidence among the adult females. In human being genome, there exists series of image cDNA sequences. The clones are collections of the DNA vectors which feature cDNAs.Research have it that this is also evident in other organisms such as the mouse, rats and other small sized rodents including mammals. The human AID cDNA can be accessed from American type culture collection sites including the open bio-systems.
QUESTION 5
Much commercial urgency globally does offer a plasmid which has cDNA sequence regarding the human AID. Our research in various data based on sources provided a couple of them. The selected few includes the following the Dana-Farber/Harvard Cancer Center (df/hcc) DNA resource, plasmid information database (plasmid) and also the DNA center websites located in the United States.
QUESTION 6
Aligning the cDNA sequence using the encoded protein sequence
Sbjct121TCTTCTTCTGACTCTGCTGACAATCTGTCTGAAAAATTGGAAAGAGAATGGGACAGAGAA 180
CDS: cystic fibrosis41S S S D S E A D N L S E D K L E R E W D R E

QUESTION 7
The design primers for PCR reaction was generated together with the corresponding cDNA portions by Phusion DNA polymerase using the Halo-LIC vector.
CDS: Putative 1 21 R I P I L D R K G Y R Y Q Y L E L S D I Y Q I
Query:193AGACCAATTTTGAGGAAGAGGATACTAGACAGCGTCCTGGAATTGTCAGACATATACCAAATC 252Sbjct61 AGACCAATTTTGAGAAAAGGATATAGACAGCGCCTGGAATTGTCAGACATATACCATATC 120
QUESTION 8
The mutagenic forward and reverse primer generated using the staggered primers with the assumption that it was mutated at one individual critical residue (c90 in the sequence NP_065712).
Under this, it is always advisable to showcase the double stranded DNA.to change the single stranded cDNA,(A SECTION with about 80 not having to be mutated nucleotide in the middle section).The single stranded is then cut and pasted inside the text input dialogue box then the command “convert” is made. A double stranded DNA sequence is generated. Note that to preserve the needed alignments of both DNA sequences; one is advised to change word character style to courier type. The following was mutated when forwarded from 8 to 4 then reversed from 4 to 8.the result is as shown below.
8’-GTTCCAACGGCCATGGGGGATATTTTTGAG-4’ mutagenic forward mutated at one individual critical residue (c90 in the sequence NP_065712).
4’-CCTACTTCTCTTTCTTCTCCTATAACTTCAAGGTTGCCGGTAC-8’ mutagenic reverse primer generated using the staggered primers with the assumption that it was mutated at one individual critical residue (c90 in the sequence NP_065712).